13575009990

Committed 27 Feb 2025 08:11PM UTC coverage: 36.409% (+36.4%) from 0.0%

Build # 13575009990

Build Type

Pull #90

github

Committed by

web-flow

Commit Message

Merge 2912168c2 into 0ad54ba86

Pull Request Pull Request #90: Rnahybrid add targetbreaking

Run Details

350 of 410 new or added lines in 9 files covered. (85.37%)

1472 of 4043 relevant lines covered (36.41%)

0.36 hits per line

Source File
Press 'n' to go to next uncovered line, 'b' for previous

98.91

/Misc/Applications/RNAhybrid/tests/test_input.py

1	import sys	1✔
2	from os.path import dirname, join	1✔
3	sys.path.append(dirname(__file__) + '/../')	1✔
4
5	from io import StringIO	1✔
6	from unittest import TestCase, main	1✔
7
8	from input import read_fasta, read_CT_file, disentangle_knots, nested_pairs_to_dotBracket, get_minimal_valid_substructure	1✔
9
10	def getFP(filepath):	1✔
11	return join(dirname(__file__), filepath)	1✔
12
13	class TestExecute(TestCase):	1✔
14	def setUp(self):	1✔
15	self.fp_fasta_mirna = getFP('data/mirnas.fasta')	1✔
16	self.fp_multiCT = getFP('data/multi.ct')	1✔
17	self.fp_sars = getFP('data/SARS-CoV-2_Full_Length_Secondary_Structure_Map.ct')	1✔
18	self.pairs1 = {14292: 14269, 14293: 14268, 14307: 14437, 14308: 14436, 14309: 14323}	1✔
19	self.pairs2 = {27149: 27127, 27150: 27126, 27164: 27330, 27165: 27329}	1✔
20	self.pairs3 = {28395: 28379, 28396: 28377, 28397: 28376, 28398: 28375, 28399: 28374, 28410: 28404, 28411: 28403}	1✔
21	self.pairs4 = {4060: 4053, 4061: 4052, 4062: 4051, 4063: 4050, 4067: 4048, 4068: 4047, 4069: 4046, 4071: 4144, 4072: 4143, 4073: 4142, 4074: 4141, 4075: 4140, 4076: 4139}	1✔
22
23	def tearDown(self):	1✔
24	pass	1✔
25
26	def test_read_fasta(self):	1✔
27	exp = [	1✔
28	('hsa-miR-21-5p::NC_000017.11:59841273-59841295(+)', 'AGCTTATCAGACTGATGTTGAC'),
29	('hsa-let-7i-5p::NC_000012.12:62603691-62603713(+)', 'GAGGTAGTAGTTTGTGCTGTTG'),
30	('hsa-miR-192-5p::NC_000011.10:64891203-64891224(-)', 'TCTGACCTATGAATTGACAGC'),
31	('hsa-miR-151a-3p::NC_000008.11:140732587-140732608(-)', 'ACTAGACtgaagctccttgag'),
32	('hsa-miR-27b-3p::NC_000009.12:95085505-95085526(+)', 'TCACAGTGGCTAAGTTCTGCA')]
33	obs = read_fasta(self.fp_fasta_mirna)	1✔
34	self.assertEqual(exp, list(obs))	1✔
35
36	def test_read_CT_file(self):	1✔
37	with self.assertRaises(ValueError) as e:	1✔
38	obs = list(read_CT_file(getFP('data/broken.ct')))	1✔
39	with self.assertRaises(ValueError) as e:	1✔
40	obs = list(read_CT_file(getFP('data/broken_missing.ct')))	1✔
41
42	exp = [	1✔
43	('A stem-loop structure (with a bulge)',
44	'GGGCAAUCCUCUUCGGGCCC',
45	{1: 20, 2: 19, 3: 18, 4: 17, 8: 16, 9: 15, 15: 9, 16: 8, 17: 4, 18: 3, 19: 2, 20: 1}),
46	('A pseudo-knot structure',
47	'GAUGGCACUCCCAUCAAUUGGAGC',
48	{1: 15, 2: 14, 3: 13, 4: 12, 5: 11, 8: 23, 9: 22, 10: 21, 11: 5, 12: 4, 13: 3, 14: 2, 15: 1, 21: 10, 22: 9, 23: 8})]
49	obs = read_CT_file(self.fp_multiCT)	1✔
50
51	obs = list(read_CT_file(getFP('data/SARS-CoV-2_Full_Length_Secondary_Structure_Map.ct')))[0]	1✔
52	self.assertEqual('finalStructure wPKs', obs[0])	1✔
53	self.assertEqual(29903, len(obs[1]))	1✔
54	self.assertTrue(obs[1].endswith('ACAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA'))	1✔
55	self.assertTrue(len(obs[1]) > len(obs[2]))	1✔
56
57	def test_disentangle_knots(self):	1✔
58	obs = disentangle_knots(next(read_CT_file(getFP('data/earlyKnot.ct')))[2], verbose=None)	1✔
59	self.assertEqual(len(obs['nested']), 6*2)	1✔
60	self.assertEqual(len(obs['knotted']), 3*2)	1✔
61
62	obs = disentangle_knots(next(read_CT_file(getFP('data/lateKnot.ct')))[2], verbose=None)	1✔
63	self.assertEqual(len(obs['nested']), 6*2)	1✔
64	self.assertEqual(len(obs['knotted']), 3*2)	1✔
65
66	obs = disentangle_knots(next(read_CT_file(self.fp_sars))[2], verbose=None)	1✔
67	self.assertEqual(len(obs['nested']), 8681*2)	1✔
68	self.assertEqual(len(obs['knotted']), 7*2)	1✔
69
70	errFile = StringIO("")	1✔
71	obs = disentangle_knots({1: 4, 2: 5}, errFile)	1✔
72	self.assertEqual(len(obs['nested']), 1*2)	1✔
73	self.assertEqual(len(obs['knotted']), 1*2)	1✔
74	self.assertEqual(errFile.getvalue(), "Warning: 1 of 2 base-pairs in your structure are pseudoknotted, i.e. crossing.\n")	1✔
75
76	def test_nested_pairs_to_dotBracket(self):	1✔
77	exp = '((......................)).............(((.............)................................................................................................................))'	1✔
78	obs = nested_pairs_to_dotBracket(self.pairs1)	1✔
79	self.assertEqual(exp, obs)	1✔
80
81	exp = '((.....................)).............((...................................................................................................................................................................))'	1✔
82	obs = nested_pairs_to_dotBracket(self.pairs2)	1✔
83	self.assertEqual(exp, obs)	1✔
84
85	exp = '((((.(...............)))))...((.....))'	1✔
86	obs = nested_pairs_to_dotBracket(self.pairs3)	1✔
87	self.assertEqual(exp, obs)	1✔
88
89	exp = '(((.((((......))))...))).((((((..............................................................))))))'	1✔
90	obs = nested_pairs_to_dotBracket(self.pairs4)	1✔
91	self.assertEqual(exp, obs)	1✔
92
93	exp = '....(....)..............((...(((....)))..))...............'	1✔
94	obs = nested_pairs_to_dotBracket(	1✔
95	{24728: 24741, 24729: 24740, 24730: 24739, 24731: 24738, 24732: 24737, 24742: 24785, 24743: 24784, 24744: 24783, 24745: 24781, 24746: 24780, 24747: 24779, 24748: 24776, 24749: 24775, 24750: 24772, 24751: 24771, 24752: 24770, 24753: 24769, 24757: 24766, 24758: 24765, 24759: 24764},
96	[24738, 24739, 24740, 24741, 24742, 24743, 24744, 24745, 24746, 24747, 24748, 24749, 24750, 24751])
97	self.assertEqual(exp, obs)	1✔
98
99	with self.assertRaises(ValueError):	1✔
100	obs = nested_pairs_to_dotBracket({1: 4, 2: 5})	1✔
101
102	def test_get_minimal_valid_substructure(self):	1✔
103	fullSARS = list(read_CT_file(getFP('data/SARS-CoV-2_Full_Length_Secondary_Structure_Map.ct')))[0]	1✔
104
105	obs = get_minimal_valid_substructure(fullSARS[2], self.pairs1)	1✔
106	self.assertEqual(nested_pairs_to_dotBracket(obs), '((((.((((((.......))))))..))))......(((((((((...........))..((((((.((....)).))))))..(...(((((.....)))))...).(((......)))...(((((.((((((.(((..............))).)))).))))))).)))))))')	1✔
107
108	obs = get_minimal_valid_substructure(fullSARS[2], self.pairs2)	1✔
109	self.assertEqual(nested_pairs_to_dotBracket(obs), '(((((.(((.(((.....................))).))).)))))((((((...(((((((((((.((((...((((..(((((((((...))))).))))))))....).)))...))))))).......)))).(((((((((.......(((.((((....)))).)))..............)))))))))...............))))))')	1✔
110
111	obs = get_minimal_valid_substructure(fullSARS[2], self.pairs3)	1✔
112	self.assertEqual(nested_pairs_to_dotBracket(obs), '((((((.((((.........)))))))))).((.....))')	1✔
113
114	obs = get_minimal_valid_substructure(fullSARS[2], self.pairs4)	1✔
115	self.assertEqual(nested_pairs_to_dotBracket(obs), '(((((((((......))))..)))))((((((.....(((...((((((((((.((......................)).)))))))))))))))))))')	1✔
116
117	exp_db = '((((((.....))))))((((..((((((((..(((..((((((((....)))))..)))))).)))))))).((((........))))..............))))' # 31 pairs	1✔
118	exp_pairs = {	1✔
119	839: 851, 840: 850, 841: 849, 842: 848, 848: 842, 850: 840,
120	852: 838, 853: 837, 854: 943, 855: 942, 856: 941, 857: 940,
121	862: 906, 837: 853, 838: 852, 851: 839, 849: 841, 943: 854,
122	942: 855, 941: 856, 940: 857, 860: 908, 908: 860, 861: 907,
123	907: 861, 906: 862, 863: 905, 905: 863, 864: 904, 904: 864,
124	865: 903, 903: 865, 866: 902, 902: 866, 867: 901, 901: 867,
125	870: 899, 899: 870, 871: 898, 898: 871, 872: 897, 897: 872,
126	875: 896, 896: 875, 876: 895, 895: 876, 877: 894, 894: 877,
127	878: 891, 891: 878, 879: 890, 890: 879, 880: 889, 889: 880,
128	881: 888, 888: 881, 882: 887, 887: 882, 910: 925, 925: 910,
129	911: 924, 924: 911, 912: 923, 923: 912, 913: 922, 922: 913}
130	novel_target_pairing_partners = [int(x) for x in '839,840,841,842,843,845,846,847,848,850,852,853,854,855,856,857,858,859,862'.split(',')]	1✔
131	original_target_pairs = {o: c for o, c in {x: fullSARS[2].get(x, -1) for x in novel_target_pairing_partners}.items() if c != -1}	1✔
132
133	obs_ext_pairs = get_minimal_valid_substructure(fullSARS[2], original_target_pairs)	1✔
134	self.assertEqual(exp_pairs, obs_ext_pairs)	1✔
135
136	obs = nested_pairs_to_dotBracket(obs_ext_pairs)	1✔
137	self.assertEqual(exp_db, obs)	1✔
138
139	pair_subset = {28395: 28379, 28396: 28377, 28397: 28376, 28398: 28375, 28399: 28374, 28410: 28404, 28411: 28403}	1✔
140	exp = {28395: 28379, 28396: 28377, 28397: 28376, 28398: 28375, 28399: 28374, 28410: 28404, 28411: 28403, 28374: 28399, 28375: 28398, 28376: 28397, 28377: 28396, 28379: 28395, 28380: 28394, 28394: 28380, 28381: 28393, 28393: 28381, 28382: 28392, 28392: 28382, 28400: 28373, 28373: 28400, 28401: 28372, 28372: 28401, 28403: 28411, 28404: 28410}	1✔
141	obs = get_minimal_valid_substructure(fullSARS[2], pair_subset)	1✔
142	self.assertEqual(exp, obs)	1✔
143
144	if __name__ == '__main__':	1✔
NEW 145	main()	×

jlab / fold-grammars / 13575009990

Source File Press 'n' to go to next uncovered line, 'b' for previous

Source File
Press 'n' to go to next uncovered line, 'b' for previous